ID: 1200862815

View in Genome Browser
Species Human (GRCh38)
Location Y:8010891-8010913
Sequence GAGTCACACTACCTGGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200862808_1200862815 23 Left 1200862808 Y:8010845-8010867 CCAGTTAGATGTCACAATCCACC No data
Right 1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG No data
1200862811_1200862815 5 Left 1200862811 Y:8010863-8010885 CCACCTTGTGGGCAGAACACTGG No data
Right 1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG No data
1200862813_1200862815 2 Left 1200862813 Y:8010866-8010888 CCTTGTGGGCAGAACACTGGCAG No data
Right 1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200862815 Original CRISPR GAGTCACACTACCTGGATAC TGG Intergenic
No off target data available for this crispr