ID: 1200862815 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:8010891-8010913 |
| Sequence | GAGTCACACTACCTGGATAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200862808_1200862815 | 23 | Left | 1200862808 | Y:8010845-8010867 | CCAGTTAGATGTCACAATCCACC | No data | ||
| Right | 1200862815 | Y:8010891-8010913 | GAGTCACACTACCTGGATACTGG | No data | ||||
| 1200862811_1200862815 | 5 | Left | 1200862811 | Y:8010863-8010885 | CCACCTTGTGGGCAGAACACTGG | No data | ||
| Right | 1200862815 | Y:8010891-8010913 | GAGTCACACTACCTGGATACTGG | No data | ||||
| 1200862813_1200862815 | 2 | Left | 1200862813 | Y:8010866-8010888 | CCTTGTGGGCAGAACACTGGCAG | No data | ||
| Right | 1200862815 | Y:8010891-8010913 | GAGTCACACTACCTGGATACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200862815 | Original CRISPR | GAGTCACACTACCTGGATAC TGG | Intergenic | ||
| No off target data available for this crispr | |||||