ID: 1200863688

View in Genome Browser
Species Human (GRCh38)
Location Y:8019890-8019912
Sequence GAATGAAAACAGTGTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200863686_1200863688 6 Left 1200863686 Y:8019861-8019883 CCTCATTTATAGGCTCTGTTTAT No data
Right 1200863688 Y:8019890-8019912 GAATGAAAACAGTGTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200863688 Original CRISPR GAATGAAAACAGTGTCAGCT GGG Intergenic
No off target data available for this crispr