ID: 1200865173

View in Genome Browser
Species Human (GRCh38)
Location Y:8035886-8035908
Sequence TGGGAACCTTTATGTATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200865169_1200865173 1 Left 1200865169 Y:8035862-8035884 CCTCTTTCATGGCTCTGCCTACA No data
Right 1200865173 Y:8035886-8035908 TGGGAACCTTTATGTATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200865173 Original CRISPR TGGGAACCTTTATGTATCAC TGG Intergenic
No off target data available for this crispr