ID: 1200868662

View in Genome Browser
Species Human (GRCh38)
Location Y:8073846-8073868
Sequence GTGTGTCCATATGAGCACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200868662_1200868667 27 Left 1200868662 Y:8073846-8073868 CCTACGTGCTCATATGGACACAC No data
Right 1200868667 Y:8073896-8073918 TTAGTCAACATCTCTCCTATAGG No data
1200868662_1200868663 4 Left 1200868662 Y:8073846-8073868 CCTACGTGCTCATATGGACACAC No data
Right 1200868663 Y:8073873-8073895 TTACATATTGTCCTAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200868662 Original CRISPR GTGTGTCCATATGAGCACGT AGG (reversed) Intergenic
No off target data available for this crispr