ID: 1200869387

View in Genome Browser
Species Human (GRCh38)
Location Y:8081131-8081153
Sequence TCACCAAGTCTGCTATAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200869382_1200869387 24 Left 1200869382 Y:8081084-8081106 CCTAGTCAGAAAAATCACACAAC No data
Right 1200869387 Y:8081131-8081153 TCACCAAGTCTGCTATAGACAGG No data
1200869385_1200869387 2 Left 1200869385 Y:8081106-8081128 CCTGGGTACAGCCTCAAATAATA No data
Right 1200869387 Y:8081131-8081153 TCACCAAGTCTGCTATAGACAGG No data
1200869386_1200869387 -9 Left 1200869386 Y:8081117-8081139 CCTCAAATAATATGTCACCAAGT No data
Right 1200869387 Y:8081131-8081153 TCACCAAGTCTGCTATAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200869387 Original CRISPR TCACCAAGTCTGCTATAGAC AGG Intergenic
No off target data available for this crispr