ID: 1200871083

View in Genome Browser
Species Human (GRCh38)
Location Y:8099141-8099163
Sequence TCTCTCAGTAGACCAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200871083_1200871085 6 Left 1200871083 Y:8099141-8099163 CCTGCTATTGGTCTACTGAGAGA No data
Right 1200871085 Y:8099170-8099192 TTCCTTCTGGTTTAATTATTAGG No data
1200871083_1200871084 -7 Left 1200871083 Y:8099141-8099163 CCTGCTATTGGTCTACTGAGAGA No data
Right 1200871084 Y:8099157-8099179 TGAGAGATTTAACTTCCTTCTGG No data
1200871083_1200871087 10 Left 1200871083 Y:8099141-8099163 CCTGCTATTGGTCTACTGAGAGA No data
Right 1200871087 Y:8099174-8099196 TTCTGGTTTAATTATTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200871083 Original CRISPR TCTCTCAGTAGACCAATAGC AGG (reversed) Intergenic
No off target data available for this crispr