ID: 1200882031

View in Genome Browser
Species Human (GRCh38)
Location Y:8224588-8224610
Sequence ACTTGAAATCGGAAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200882031_1200882038 10 Left 1200882031 Y:8224588-8224610 CCCTACACCTTCCGATTTCAAGT No data
Right 1200882038 Y:8224621-8224643 CCTCAGCCTTCCAAATAGCTGGG 0: 191
1: 8128
2: 117404
3: 331976
4: 476476
1200882031_1200882036 9 Left 1200882031 Y:8224588-8224610 CCCTACACCTTCCGATTTCAAGT No data
Right 1200882036 Y:8224620-8224642 GCCTCAGCCTTCCAAATAGCTGG 0: 136
1: 6398
2: 101407
3: 279508
4: 424163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200882031 Original CRISPR ACTTGAAATCGGAAGGTGTA GGG (reversed) Intergenic
No off target data available for this crispr