ID: 1200885206

View in Genome Browser
Species Human (GRCh38)
Location Y:8260672-8260694
Sequence CATTTCATCCTGAGGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200885202_1200885206 -1 Left 1200885202 Y:8260650-8260672 CCATTTACAGTGTGGAGGACCAC No data
Right 1200885206 Y:8260672-8260694 CATTTCATCCTGAGGCTTGGAGG No data
1200885199_1200885206 9 Left 1200885199 Y:8260640-8260662 CCACTAGGTGCCATTTACAGTGT No data
Right 1200885206 Y:8260672-8260694 CATTTCATCCTGAGGCTTGGAGG No data
1200885198_1200885206 10 Left 1200885198 Y:8260639-8260661 CCCACTAGGTGCCATTTACAGTG No data
Right 1200885206 Y:8260672-8260694 CATTTCATCCTGAGGCTTGGAGG No data
1200885197_1200885206 13 Left 1200885197 Y:8260636-8260658 CCTCCCACTAGGTGCCATTTACA No data
Right 1200885206 Y:8260672-8260694 CATTTCATCCTGAGGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200885206 Original CRISPR CATTTCATCCTGAGGCTTGG AGG Intergenic
No off target data available for this crispr