ID: 1200886508

View in Genome Browser
Species Human (GRCh38)
Location Y:8277584-8277606
Sequence CAGGATCAGTTGAGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200886508_1200886512 13 Left 1200886508 Y:8277584-8277606 CCATCCAGCCTCAACTGATCCTG No data
Right 1200886512 Y:8277620-8277642 TTCTAAGTAGCTGAAACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200886508 Original CRISPR CAGGATCAGTTGAGGCTGGA TGG (reversed) Intergenic
No off target data available for this crispr