ID: 1200886508 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:8277584-8277606 |
Sequence | CAGGATCAGTTGAGGCTGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1200886508_1200886512 | 13 | Left | 1200886508 | Y:8277584-8277606 | CCATCCAGCCTCAACTGATCCTG | No data | ||
Right | 1200886512 | Y:8277620-8277642 | TTCTAAGTAGCTGAAACTACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1200886508 | Original CRISPR | CAGGATCAGTTGAGGCTGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |