ID: 1200886658

View in Genome Browser
Species Human (GRCh38)
Location Y:8278584-8278606
Sequence TACTGTATGTAGAAGTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200886658_1200886662 10 Left 1200886658 Y:8278584-8278606 CCCCCAGACTTCTACATACAGTA No data
Right 1200886662 Y:8278617-8278639 AAATTTGCTAATTCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200886658 Original CRISPR TACTGTATGTAGAAGTCTGG GGG (reversed) Intergenic
No off target data available for this crispr