ID: 1200886964

View in Genome Browser
Species Human (GRCh38)
Location Y:8280305-8280327
Sequence GGCATAATGGGACCAGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200886964_1200886972 0 Left 1200886964 Y:8280305-8280327 CCCGGTCCTGGTCCCATTATGCC No data
Right 1200886972 Y:8280328-8280350 CCAGCACGCAACGAACTCGCTGG No data
1200886964_1200886975 22 Left 1200886964 Y:8280305-8280327 CCCGGTCCTGGTCCCATTATGCC No data
Right 1200886975 Y:8280350-8280372 GAGGTCCTTCACTTGTAGCTGGG No data
1200886964_1200886973 3 Left 1200886964 Y:8280305-8280327 CCCGGTCCTGGTCCCATTATGCC No data
Right 1200886973 Y:8280331-8280353 GCACGCAACGAACTCGCTGGAGG No data
1200886964_1200886974 21 Left 1200886964 Y:8280305-8280327 CCCGGTCCTGGTCCCATTATGCC No data
Right 1200886974 Y:8280349-8280371 GGAGGTCCTTCACTTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200886964 Original CRISPR GGCATAATGGGACCAGGACC GGG (reversed) Intergenic
No off target data available for this crispr