ID: 1200894840

View in Genome Browser
Species Human (GRCh38)
Location Y:8364242-8364264
Sequence AGATGTAAACTGCAGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200894837_1200894840 14 Left 1200894837 Y:8364205-8364227 CCTCAACTGCATTTCCTTCAGTT 0: 1
1: 0
2: 1
3: 32
4: 357
Right 1200894840 Y:8364242-8364264 AGATGTAAACTGCAGTTGAATGG 0: 1
1: 0
2: 2
3: 28
4: 230
1200894838_1200894840 0 Left 1200894838 Y:8364219-8364241 CCTTCAGTTGCTCATATCAGCCA 0: 1
1: 0
2: 3
3: 14
4: 150
Right 1200894840 Y:8364242-8364264 AGATGTAAACTGCAGTTGAATGG 0: 1
1: 0
2: 2
3: 28
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200894840 Original CRISPR AGATGTAAACTGCAGTTGAA TGG Intergenic
902147538 1:14416002-14416024 AGATGGAAAATGCAGCTGAGGGG + Intergenic
902544227 1:17176859-17176881 AGATGTCAACAGAAGCTGAATGG + Intergenic
903025870 1:20429575-20429597 ATATTTAAGCTGCAGCTGAAGGG - Intergenic
904647595 1:31979444-31979466 AGGTTTAAACTGGATTTGAAAGG - Intergenic
907068284 1:51508899-51508921 ATATTTAAACTGTACTTGAAAGG - Intronic
909064214 1:70914277-70914299 AGATATCAACTGCAGTTTATAGG - Intronic
910037918 1:82810863-82810885 AGATGAAAACTGCAGTGAATAGG - Intergenic
910506565 1:87955988-87956010 AGATGTTAAGTGCAGTTCAGTGG + Intergenic
910684900 1:89906118-89906140 AGAAGTAAACAGCAGTTGGGGGG - Intronic
911834428 1:102597973-102597995 AGAAGTAAACTGCAGCATAATGG + Intergenic
916327123 1:163574845-163574867 AGATGTTAACTGCATTCCAAAGG + Intergenic
917047453 1:170877285-170877307 AAAGATACACTGCAGTTGAAGGG - Intergenic
917675054 1:177310994-177311016 ATTTGTAAACTCCAGCTGAAAGG + Intergenic
918769807 1:188542631-188542653 AAATATAAACTCCAGTTTAAAGG + Intergenic
919477592 1:198048486-198048508 AAATGTAAAATACATTTGAAAGG - Intergenic
920039632 1:203086982-203087004 AGATTTAAACTGAGTTTGAAGGG - Intergenic
921270486 1:213465002-213465024 AGATGTAAGCTGCCCTGGAAAGG - Intergenic
921666140 1:217874074-217874096 AGATATAAACTGGAGTTCAAGGG + Intergenic
1064664374 10:17635565-17635587 AGATCTAAACTGCAATTAAAGGG - Intergenic
1065329327 10:24577791-24577813 ACATGTACTCTCCAGTTGAAAGG - Intergenic
1068721294 10:60249158-60249180 AGATATATATAGCAGTTGAATGG + Intronic
1070600375 10:77862078-77862100 AGACAAAAACTTCAGTTGAATGG - Intronic
1074201051 10:111235528-111235550 AGAGGTAATCTGGAGGTGAAAGG + Intergenic
1075534810 10:123261935-123261957 ACATGTAAGCTGCAGTGGATGGG + Intergenic
1076238363 10:128883334-128883356 AGATGTAAACTGTAAATCAAAGG - Intergenic
1080238087 11:30095223-30095245 AGATTTAAACTAAAGTTAAAAGG - Intergenic
1080951855 11:37043084-37043106 ATAAGTAAACTGAAGTTGGAGGG - Intergenic
1081072947 11:38632577-38632599 ATATGCAGACTTCAGTTGAATGG + Intergenic
1082116918 11:48338551-48338573 AGAAGTAATATGCAGTGGAAGGG + Intergenic
1082207257 11:49452730-49452752 AGATGTTTACTGAAGTAGAAAGG - Intergenic
1082256873 11:50041759-50041781 AGAAGTAATATGCAGTGGAAGGG - Intergenic
1082942736 11:58725696-58725718 AGAAGTAAAGTGCATTTGGAAGG + Intronic
1083291321 11:61691842-61691864 AGGTGGAAACTGCAGCTGAGAGG - Intronic
1084904252 11:72333943-72333965 AGATATGAGCTGCAGTGGAAGGG + Intronic
1086648021 11:89249003-89249025 AGATGTTTACTGAAGTAGAAAGG + Intronic
1087248237 11:95866052-95866074 AGATCTGAACTACAGTTGAATGG + Intronic
1087316416 11:96608624-96608646 AGTTATCAACTGCTGTTGAAAGG + Intergenic
1087338595 11:96874578-96874600 AGATGAAAAATGCATTTTAAAGG - Intergenic
1087599640 11:100296961-100296983 CCATGAAATCTGCAGTTGAAAGG - Intronic
1088292696 11:108258217-108258239 TGATTTAAAATTCAGTTGAATGG + Intronic
1088706060 11:112465760-112465782 TGATTTAAACTGCATTTGCACGG + Intergenic
1089427028 11:118386386-118386408 AGAAGAAAGGTGCAGTTGAAGGG - Intronic
1089835379 11:121365809-121365831 CTCTGTAAACGGCAGTTGAAAGG + Intergenic
1093166400 12:15808621-15808643 AAAGGTAAACTGCTGTTGCAAGG + Intronic
1093337462 12:17923527-17923549 ACATGTAAACTGAAAATGAAAGG + Intergenic
1093744871 12:22729056-22729078 AGATGCCAACTGAAGCTGAATGG - Intergenic
1093826926 12:23703583-23703605 AGAAGTCAACTGCAGTGGAATGG + Intronic
1095341891 12:41099693-41099715 AGATGAAAACAGCAGTGGTAGGG - Intergenic
1095494644 12:42771612-42771634 AGATTTAAACTACATTTCAAAGG + Intergenic
1096765735 12:53887525-53887547 AGCTGTAAAATGCAGATGAGAGG - Intergenic
1097952079 12:65442409-65442431 AATTGAGAACTGCAGTTGAATGG + Intronic
1098069583 12:66657720-66657742 AGCTTTAAAATGCAGTGGAAAGG - Intronic
1099312428 12:81044143-81044165 TGATGTAATCTCCAGTTGACAGG + Intronic
1100621985 12:96285462-96285484 AGATGGAAAATGCAGTCAAAGGG + Intronic
1101330716 12:103755610-103755632 AGATGTGAACTGCACCTGCAAGG + Exonic
1104324079 12:127779481-127779503 AGATGTAAACAGAAGTTGCTGGG - Intergenic
1106101848 13:26700405-26700427 AGGTGTAAATCCCAGTTGAAGGG + Intergenic
1106394097 13:29363714-29363736 ATATGTGAACTGAAGGTGAAAGG - Intronic
1108434441 13:50387892-50387914 AGAAGTAAACTGCAGCTGTTGGG - Intronic
1109386890 13:61641922-61641944 AAATGTATTCTGCAGTTGCATGG + Intergenic
1115120948 14:29937139-29937161 ATCTTTAAACTGTAGTTGAACGG - Intronic
1116864642 14:50021855-50021877 AGATGAACACTTCAGTTGGAGGG - Intergenic
1117481431 14:56149111-56149133 AGATTTAAACCCTAGTTGAAAGG - Intronic
1117489822 14:56235425-56235447 AGATGTCAACTGGAGTTCACGGG - Intronic
1117812511 14:59563509-59563531 AGATACAAACTGCATTTGATGGG - Intronic
1117928250 14:60808311-60808333 AGTTGAAAACTGCATTAGAAAGG - Exonic
1118574364 14:67226691-67226713 AGATGCACACTGTAGGTGAAAGG + Intronic
1119079120 14:71675344-71675366 AGATGGAAACTGTAGTGAAAGGG - Intronic
1119168117 14:72512820-72512842 AGATGATATCTGCAGCTGAAGGG - Intronic
1120291222 14:82573344-82573366 AAATGTAAACTCCACTGGAAAGG + Intergenic
1120412653 14:84176629-84176651 AGATGTAAACTACAGCTGAATGG + Intergenic
1120662736 14:87270030-87270052 AGATGCAAATTGTAGATGAAAGG + Intergenic
1120928027 14:89817691-89817713 ACAAGTAAAATGCAGTTGCAAGG + Intronic
1121480216 14:94262282-94262304 ACATGTAAACTGGGGTGGAAGGG - Intronic
1123787996 15:23691420-23691442 AGATATAAACAGCAATGGAAGGG + Intergenic
1126073193 15:44883724-44883746 AGATGTACAAGGCAGTGGAATGG + Intergenic
1126213114 15:46122225-46122247 ATCTGTAATCTGCAGATGAATGG - Intergenic
1129305087 15:74654456-74654478 AGATGATAACTGCCTTTGAAAGG + Intronic
1129750310 15:78058347-78058369 AGTTGTAAAGTGCTGTAGAAGGG - Intronic
1133959500 16:10480799-10480821 AGATGTAAACTATAGCTTAAAGG + Intronic
1135387631 16:22057809-22057831 ACATGTAAACTGGAAATGAAAGG + Intronic
1135418457 16:22287603-22287625 AAATTTAAACTGGAGTTTAATGG + Exonic
1141226536 16:82121535-82121557 AGATGTAAACTCCTGCTGAATGG - Intergenic
1143725970 17:8846694-8846716 ACATTTAAACAGCACTTGAAAGG + Intronic
1144435609 17:15237406-15237428 AGAGGTAAGCTGCTGTTGAATGG - Intronic
1146633582 17:34487973-34487995 AAATGCAAACTGCAGAAGAAGGG + Intergenic
1149345584 17:55731864-55731886 AACTGTAAACTGCATTTGAAAGG + Exonic
1149586965 17:57796471-57796493 AAATGTAAAATCCAGATGAAAGG + Intergenic
1151345917 17:73501001-73501023 GGATGTAAACTTAAGCTGAAAGG + Intronic
1203199050 17_KI270729v1_random:258730-258752 AGATATAAAATGGAATTGAATGG + Intergenic
1203208651 17_KI270730v1_random:59470-59492 AGATATAAAATGGAATTGAATGG + Intergenic
1154155500 18:11941158-11941180 TTATTTAAACTGCAGCTGAAAGG + Intergenic
1155055579 18:22179430-22179452 ACATGTGAAATGCAGGTGAATGG - Intronic
1157402299 18:47398684-47398706 AGATGGAGACTGCAGTGCAAGGG - Intergenic
1158482799 18:57836646-57836668 TGATGTAAACTGCAGTCTGAGGG - Intergenic
1167280777 19:48567064-48567086 AGATGTAAACTCCTTTTGAGTGG + Intronic
926553183 2:14325305-14325327 AGAAGTTTACTGAAGTTGAAGGG + Intergenic
926919203 2:17923453-17923475 AAATGTAAAATGCACTTCAAAGG - Intronic
929535731 2:42783237-42783259 AGCTCCAAACTGCAGCTGAAGGG - Intronic
930684433 2:54292731-54292753 AGATGTTAAGTCCAGTTCAAAGG - Intronic
931013619 2:57948914-57948936 TGAAGTAAACTGCAGTAGAAAGG + Intronic
931343226 2:61422967-61422989 AAATGCAAACTGCAGTTTAATGG - Intronic
932208895 2:69910402-69910424 AGATGTAAAATGAAGATCAAGGG - Intronic
935484532 2:103637311-103637333 AGATTTAAAATGCACTTCAAAGG - Intergenic
937517491 2:122671761-122671783 AGATGTAAATTGCAGTATAATGG + Intergenic
937665275 2:124480009-124480031 ATATGTCAACTTCAGTTGAATGG - Intronic
939404175 2:141734737-141734759 TGCTGCAAACTGCAGGTGAATGG + Intronic
939415942 2:141897249-141897271 AAATGTAAAATAAAGTTGAAAGG + Intronic
940332954 2:152495138-152495160 ATATGTAAATGGCAGTTCAATGG + Intronic
940562341 2:155314245-155314267 AGATGTAAATTACAGCTGAATGG + Intergenic
940663810 2:156581541-156581563 AGATGTAAAGTATATTTGAAGGG + Intronic
941621576 2:167785008-167785030 AGATGTACACGGCAGATGAGTGG - Intergenic
942138884 2:172956982-172957004 AGAAGAAAACTGCAGGTGGATGG + Intronic
943779831 2:191811102-191811124 AGATGTGAACTTTAGTTCAAAGG - Intergenic
943968882 2:194376871-194376893 AAATGTAAATTCCAGTTGAATGG + Intergenic
944369705 2:198967562-198967584 AGATATGAACTACATTTGAAAGG - Intergenic
945229871 2:207575549-207575571 AAATGTTAACTACATTTGAATGG - Intronic
945779274 2:214148044-214148066 AAATTTGAACTGCAGCTGAAAGG + Intronic
946359211 2:219209067-219209089 AGATATATGCTGCAGTGGAAGGG + Intronic
946630219 2:221659064-221659086 AGATTTAAAATCCAGTTCAAGGG - Intergenic
947281675 2:228462209-228462231 TGATGTAATCTACAGTTGACTGG + Intergenic
948303589 2:236929222-236929244 AGATGCTAACTCCAGTTGATTGG - Intergenic
1169382061 20:5116439-5116461 AAAGGTAAAATTCAGTTGAAAGG - Intronic
1170762229 20:19261195-19261217 AGCTCTAAACTGCAGTAGAGAGG - Intronic
1172736757 20:37132092-37132114 AGCTCAAAACTGCAGTGGAAAGG - Intronic
1172794033 20:37524883-37524905 AGAGGGAAACTGGAGATGAAGGG - Intronic
1173293803 20:41737848-41737870 AGATGAGAACCGCAGTTGTATGG - Intergenic
1173311702 20:41902155-41902177 ATATGTAAACTTCAGCAGAAAGG - Intergenic
1177828581 21:26111424-26111446 AGATATATACTGAAGATGAAAGG + Intronic
1178016709 21:28355212-28355234 CGATGTGAACGGCACTTGAAAGG + Intergenic
1178093094 21:29184940-29184962 AAATTTAAACTGCATTTCAATGG - Intergenic
1178341746 21:31791420-31791442 AGATTTGTACTGCAGTTGATGGG - Intergenic
1178526487 21:33333954-33333976 ACATATAAACTGAAATTGAAGGG + Intronic
1182145183 22:27993085-27993107 AGATGGAAACAGCAGGTAAATGG + Intronic
1182615900 22:31590029-31590051 AGGTGTAAATCCCAGTTGAAGGG + Intronic
1182784427 22:32895017-32895039 AGATGTAAACTACGGCTGAATGG - Intronic
1183710095 22:39498281-39498303 AGATGTCTACTGCAGTCCAAGGG - Intergenic
949595691 3:5544338-5544360 ATATGTATTCTGCTGTTGAATGG + Intergenic
952787903 3:37174557-37174579 AGATGTAAATGTCAGTGGAAAGG - Exonic
955705265 3:61721060-61721082 AAATTTACAATGCAGTTGAAAGG - Intronic
955932658 3:64073240-64073262 GGATGCAAACTGAAGGTGAATGG + Intergenic
957574486 3:81990363-81990385 AGATGTTAATGGCAGTTAAAAGG + Intergenic
958858821 3:99420284-99420306 AAATGTAAAATGAAGATGAAGGG - Intergenic
959019174 3:101169560-101169582 TGTTTTAAGCTGCAGTTGAAAGG - Intergenic
959872802 3:111348022-111348044 ATATTAAAACTGCAATTGAAAGG + Intronic
960063238 3:113344990-113345012 GCAGGTAAACTGCAGTTTAATGG + Intronic
960174299 3:114498792-114498814 AGATAAAAAGTGTAGTTGAAAGG - Intronic
960369784 3:116820530-116820552 AGCTGTAAGCTTCAGTTAAAAGG + Intronic
961863159 3:129934134-129934156 ATAAGTAAACTGGAGTTGAGAGG - Intergenic
962033104 3:131621941-131621963 AGGTGGAGACTGCAGTTGCAGGG + Intronic
962623905 3:137205707-137205729 AAATGTTAACTGCAGTTAAAGGG - Intergenic
962704702 3:138031744-138031766 AGATGTCAACAGCAGTAGAAAGG - Exonic
964728657 3:159842091-159842113 TGATGATATCTGCAGTTGAATGG + Intronic
965335242 3:167425671-167425693 ACAGGTAAAATGGAGTTGAAAGG - Intergenic
966102517 3:176288989-176289011 ACGTGTAAACAGAAGTTGAAGGG + Intergenic
967004808 3:185374177-185374199 AGATGTATACTGCAGGTCACTGG + Intronic
969136375 4:5032528-5032550 AGATGGAAAATGCAGTTTAGGGG - Intergenic
970905564 4:21212167-21212189 AGATGAAAAATGCAGTCTAAAGG + Intronic
972195994 4:36654574-36654596 AGATGAAAACTAGAGTTGAAGGG + Intergenic
972737768 4:41862231-41862253 AGAACTAACCTGCAGTTGATAGG + Intergenic
972804372 4:42513066-42513088 AGTTGCAAACTCCAGTTCAAGGG - Intronic
972810152 4:42575533-42575555 ATATGATAACTGCAGATGAATGG - Intronic
974731275 4:65869387-65869409 AGATTAAAACTTCAGTTCAAAGG + Intergenic
974764317 4:66322511-66322533 AGAGGTAAACTGGAGGTGAGGGG + Intergenic
975804739 4:78099967-78099989 AGAAGGAAACTGGTGTTGAATGG + Intronic
976501376 4:85794231-85794253 AGATGTAAACTGCATTATAATGG - Intronic
977103566 4:92849607-92849629 AGTTGAAAAATGGAGTTGAAGGG - Intronic
977374698 4:96187202-96187224 AGAAGTTCACTACAGTTGAAAGG - Intergenic
978524965 4:109655823-109655845 AGAGGTAAACTGAAGTTTCAAGG - Intronic
980770098 4:137360896-137360918 ACATGAAAACTGGAGTGGAAAGG + Intergenic
982022441 4:151216160-151216182 AAAAGTAAACTGCTGTTGATCGG - Intronic
982845970 4:160252942-160252964 AGGAGTAAACTGAAGTTTAAAGG - Intergenic
983195152 4:164798701-164798723 TGATGTAAACTGCAGTCTGAGGG + Intergenic
984349633 4:178573743-178573765 AAATGTAAACTAAAGTTAAAAGG + Intergenic
985760982 5:1748574-1748596 AGATATAAACAGCGGATGAAGGG + Intergenic
986521114 5:8619390-8619412 AGATGTAAACTACGGCTGAATGG + Intergenic
987602365 5:20088110-20088132 AGATGGAAAATACAGTTCAAGGG + Intronic
989636086 5:43535529-43535551 AGATGCAAACTGCAGTAGGTAGG - Exonic
992162804 5:74018784-74018806 ATATATAAACTGCAATTGGAGGG + Intergenic
995440307 5:112184148-112184170 AGATGTTAACTTCAGATGCATGG - Intronic
997801293 5:136865273-136865295 AGATGTAAGCTGCAGCAGGAGGG - Intergenic
998625298 5:143839399-143839421 ACATGTAAACTGTGGCTGAAAGG - Intergenic
999784912 5:154882267-154882289 AGATGGGAAGTGCAGTGGAAGGG - Intergenic
1003932321 6:10936721-10936743 AGATATAAACTGAAAGTGAAGGG + Intronic
1004018841 6:11758057-11758079 AGATTTGAGCTGCAGTTCAAAGG - Intronic
1006741363 6:36311374-36311396 AGCAGTTAACTGCAGTTGCAAGG + Intergenic
1007332846 6:41127451-41127473 TGTTGTAAACTGCAGAAGAAAGG + Intergenic
1009295302 6:61940186-61940208 ATATATAAATTGCAGTTAAAAGG + Intronic
1010656641 6:78519037-78519059 AGATGTAAAAGGCAGGTGAATGG - Intergenic
1015006105 6:128283726-128283748 AGAAATAAACTGCCCTTGAAAGG + Intronic
1015211905 6:130708113-130708135 AGCTCTAGCCTGCAGTTGAAAGG - Intergenic
1016174467 6:141062343-141062365 AAATGTAAACAGCAGGTAAAAGG + Intergenic
1018542396 6:164896459-164896481 AGATGTATACTGGAGTGGACAGG - Intergenic
1022035689 7:26532013-26532035 AGAAGTAAACTCCAGTAGAAGGG + Intergenic
1022592982 7:31684101-31684123 AGATGTAAACAGCAACTGACAGG - Intergenic
1023647431 7:42332480-42332502 AAAAATAATCTGCAGTTGAAAGG + Intergenic
1023920568 7:44626361-44626383 AGATATAATCTGCAGGTGTAGGG - Intronic
1024167501 7:46749532-46749554 AGATGTAAACTCCTGATGGAGGG - Intronic
1027332462 7:77113649-77113671 AAATGTCAACTGCTGTTAAAGGG + Intergenic
1027827373 7:83133864-83133886 ACATGTAAACTCCAGATAAAAGG - Intronic
1028247632 7:88500247-88500269 AGATGTAAAATGCAGTAGTCAGG - Intergenic
1028358181 7:89935112-89935134 AGATGAAAACTGCAAGTGCATGG + Intergenic
1029062079 7:97808754-97808776 ACATGTAAACTGAAAGTGAAGGG + Intergenic
1029430581 7:100526726-100526748 ACATGAAAACCTCAGTTGAATGG - Intergenic
1029783316 7:102757666-102757688 AAATGTCAACTGCTGTTAAAGGG - Intronic
1029872518 7:103709937-103709959 AGATGTAATCAGAATTTGAAAGG + Intronic
1030696298 7:112588598-112588620 AGCTGGAGACCGCAGTTGAAAGG - Intergenic
1031201098 7:118686843-118686865 ATATGTACATTGCAGTGGAATGG - Intergenic
1032101847 7:128986369-128986391 AGAGGTAAATGGGAGTTGAAAGG - Intronic
1033410605 7:141114408-141114430 AGATATACAGTGCAGCTGAAGGG - Intronic
1034650261 7:152684704-152684726 AGATGCAATCTGCAGTGGAATGG + Intergenic
1034709356 7:153177156-153177178 AAATATAAATGGCAGTTGAATGG + Intergenic
1037434609 8:18849428-18849450 AGATGTAAACTACGGCTGAATGG + Intronic
1038481269 8:27903261-27903283 AGATGTAAACTACAGCTGAATGG - Intronic
1038512069 8:28147370-28147392 AGATGGCAACTGCAGTTGTTGGG + Intronic
1038630685 8:29240480-29240502 AGGTTTAAACTGCATTGGAAAGG + Intronic
1039409636 8:37342086-37342108 AAATGTAAATTACAGTAGAATGG - Intergenic
1040377271 8:46838471-46838493 AGATGTAAACTAAGGCTGAATGG - Intergenic
1040895322 8:52362413-52362435 TGATGAAAACAGCATTTGAATGG - Intronic
1040984174 8:53275514-53275536 AGATGTAAAGTACATTTTAATGG - Intergenic
1043002500 8:74776751-74776773 AAATTTAAAATGCAGTTAAATGG - Intronic
1044398221 8:91739037-91739059 AGATGTAAACAGCAGTCTACTGG + Intergenic
1046039737 8:108887981-108888003 AGGTGTAGACTGGAGTTCAAGGG - Intergenic
1046077281 8:109328273-109328295 AGATTTACACTACAGTTAAAGGG - Intronic
1046556082 8:115775189-115775211 AGATGCAAAGTCCAGGTGAATGG - Intronic
1047476914 8:125241326-125241348 AAATGTATAATGCAGTTGAGGGG + Intronic
1047801283 8:128313191-128313213 ATTTGAAAACTGCAGTTGAAGGG - Intergenic
1048139411 8:131778641-131778663 AGAAATAAACTGCATTTGAATGG - Intergenic
1048176003 8:132153528-132153550 AGATGATAACAGCAGTTAAAAGG + Intronic
1048287006 8:133149809-133149831 AGATGGAAACTGAAGTTTGAAGG + Intergenic
1048769994 8:137884938-137884960 AGATTTAAACTGCCTTTGAAGGG + Intergenic
1050288315 9:4127419-4127441 AGATATAAACTGCAATGGGAGGG - Intronic
1050582366 9:7073693-7073715 AGATATAGGCTGCAGGTGAATGG + Intronic
1051347945 9:16169471-16169493 AATTGTAAACGGCAGTGGAATGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1053420475 9:37974461-37974483 AGATGTAGGCTGCAGAGGAAAGG - Intronic
1055496953 9:76864945-76864967 AGATATATTCTGCAGTTGACAGG - Intronic
1055691991 9:78842429-78842451 AGATGTCAACAGGAGTTGAAAGG - Intergenic
1055730381 9:79274475-79274497 AGATGTAAGCTGTAGGTGGATGG + Intergenic
1057145690 9:92757807-92757829 AGCTGCAAACTGCAGGTGCAGGG + Intronic
1059294949 9:113262082-113262104 AGATTTACACTGCAGATCAAAGG - Exonic
1060051176 9:120379457-120379479 AGATGACAACTGCAGGTGATGGG + Intergenic
1060845030 9:126829629-126829651 AGATATAAACAGGAGTTTAATGG + Intronic
1203566169 Un_KI270744v1:91703-91725 AAATTTATACTGCAGCTGAAGGG + Intergenic
1187195678 X:17081116-17081138 AGATGTGGACTTGAGTTGAAAGG + Intronic
1191055823 X:56239389-56239411 ACATGAAATCTGCATTTGAAAGG + Intronic
1191660299 X:63642539-63642561 AGAAGTAATAAGCAGTTGAAGGG + Intronic
1192769388 X:74171103-74171125 AACTGAAAACTGCAGTAGAAGGG + Intergenic
1193269672 X:79514842-79514864 AGATGATAACTGAAGTTAAAAGG + Intergenic
1193455089 X:81721931-81721953 AAAGGTAAACTGCAGCTGAGAGG - Intergenic
1194171113 X:90583687-90583709 AGGTGTAAACTTCAGTCAAAAGG - Intergenic
1195565587 X:106335603-106335625 AGAAGTAAAATGTAGTTGAGAGG + Intergenic
1196176066 X:112640274-112640296 AGATATCAAATCCAGTTGAAAGG + Intronic
1197012155 X:121578891-121578913 ACATGTAATCTGCATTTTAAAGG + Intergenic
1197038617 X:121907879-121907901 AGATGATAACTGAAGTTAAAAGG + Intergenic
1197459986 X:126729316-126729338 AGATGTAAACTACGACTGAATGG + Intergenic
1197550602 X:127887819-127887841 GGATGCAAACTGCAGCTGAGAGG + Intergenic
1198736853 X:139795281-139795303 ACATGACAACTGCAGTTGAAAGG - Intronic
1199021854 X:142888506-142888528 AGTTCTAAACTGCTGTGGAAGGG - Intergenic
1200517345 Y:4161431-4161453 AGGTGTAAACTTCAGTCAAAAGG - Intergenic
1200894840 Y:8364242-8364264 AGATGTAAACTGCAGTTGAATGG + Intergenic