ID: 1200902884

View in Genome Browser
Species Human (GRCh38)
Location Y:8450737-8450759
Sequence TACAATCCCCAATGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200902884_1200902889 22 Left 1200902884 Y:8450737-8450759 CCCTGCTTCCATTGGGGATTGTA No data
Right 1200902889 Y:8450782-8450804 TTTCTTTTTGTCACCTAGGTTGG No data
1200902884_1200902888 18 Left 1200902884 Y:8450737-8450759 CCCTGCTTCCATTGGGGATTGTA No data
Right 1200902888 Y:8450778-8450800 CTTTTTTCTTTTTGTCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200902884 Original CRISPR TACAATCCCCAATGGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr