ID: 1200906122

View in Genome Browser
Species Human (GRCh38)
Location Y:8484688-8484710
Sequence CCAGGGAAGTCTGAGGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200906122_1200906131 17 Left 1200906122 Y:8484688-8484710 CCTTAAGCCTCAGACTTCCCTGG No data
Right 1200906131 Y:8484728-8484750 CTGGGCTTGCCTTGAGAAAAAGG No data
1200906122_1200906129 -1 Left 1200906122 Y:8484688-8484710 CCTTAAGCCTCAGACTTCCCTGG No data
Right 1200906129 Y:8484710-8484732 GGCTTGCTTGAATCCTCTCTGGG No data
1200906122_1200906128 -2 Left 1200906122 Y:8484688-8484710 CCTTAAGCCTCAGACTTCCCTGG No data
Right 1200906128 Y:8484709-8484731 GGGCTTGCTTGAATCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200906122 Original CRISPR CCAGGGAAGTCTGAGGCTTA AGG (reversed) Intergenic
No off target data available for this crispr