ID: 1200906126

View in Genome Browser
Species Human (GRCh38)
Location Y:8484705-8484727
Sequence AGAGGATTCAAGCAAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200906126_1200906131 0 Left 1200906126 Y:8484705-8484727 CCCTGGGCTTGCTTGAATCCTCT No data
Right 1200906131 Y:8484728-8484750 CTGGGCTTGCCTTGAGAAAAAGG No data
1200906126_1200906133 24 Left 1200906126 Y:8484705-8484727 CCCTGGGCTTGCTTGAATCCTCT No data
Right 1200906133 Y:8484752-8484774 TTCTTATTCCTTGTGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200906126 Original CRISPR AGAGGATTCAAGCAAGCCCA GGG (reversed) Intergenic
No off target data available for this crispr