ID: 1200906127

View in Genome Browser
Species Human (GRCh38)
Location Y:8484706-8484728
Sequence GAGAGGATTCAAGCAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200906127_1200906131 -1 Left 1200906127 Y:8484706-8484728 CCTGGGCTTGCTTGAATCCTCTC No data
Right 1200906131 Y:8484728-8484750 CTGGGCTTGCCTTGAGAAAAAGG No data
1200906127_1200906133 23 Left 1200906127 Y:8484706-8484728 CCTGGGCTTGCTTGAATCCTCTC No data
Right 1200906133 Y:8484752-8484774 TTCTTATTCCTTGTGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200906127 Original CRISPR GAGAGGATTCAAGCAAGCCC AGG (reversed) Intergenic