ID: 1200906130

View in Genome Browser
Species Human (GRCh38)
Location Y:8484723-8484745
Sequence TTCTCAAGGCAAGCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200906130_1200906133 6 Left 1200906130 Y:8484723-8484745 CCTCTCTGGGCTTGCCTTGAGAA No data
Right 1200906133 Y:8484752-8484774 TTCTTATTCCTTGTGAATGTAGG No data
1200906130_1200906135 21 Left 1200906130 Y:8484723-8484745 CCTCTCTGGGCTTGCCTTGAGAA No data
Right 1200906135 Y:8484767-8484789 AATGTAGGCAGAGAAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200906130 Original CRISPR TTCTCAAGGCAAGCCCAGAG AGG (reversed) Intergenic
No off target data available for this crispr