ID: 1200906131

View in Genome Browser
Species Human (GRCh38)
Location Y:8484728-8484750
Sequence CTGGGCTTGCCTTGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200906127_1200906131 -1 Left 1200906127 Y:8484706-8484728 CCTGGGCTTGCTTGAATCCTCTC No data
Right 1200906131 Y:8484728-8484750 CTGGGCTTGCCTTGAGAAAAAGG No data
1200906122_1200906131 17 Left 1200906122 Y:8484688-8484710 CCTTAAGCCTCAGACTTCCCTGG No data
Right 1200906131 Y:8484728-8484750 CTGGGCTTGCCTTGAGAAAAAGG No data
1200906125_1200906131 10 Left 1200906125 Y:8484695-8484717 CCTCAGACTTCCCTGGGCTTGCT No data
Right 1200906131 Y:8484728-8484750 CTGGGCTTGCCTTGAGAAAAAGG No data
1200906126_1200906131 0 Left 1200906126 Y:8484705-8484727 CCCTGGGCTTGCTTGAATCCTCT No data
Right 1200906131 Y:8484728-8484750 CTGGGCTTGCCTTGAGAAAAAGG No data
1200906121_1200906131 18 Left 1200906121 Y:8484687-8484709 CCCTTAAGCCTCAGACTTCCCTG No data
Right 1200906131 Y:8484728-8484750 CTGGGCTTGCCTTGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200906131 Original CRISPR CTGGGCTTGCCTTGAGAAAA AGG Intergenic
No off target data available for this crispr