ID: 1200906133

View in Genome Browser
Species Human (GRCh38)
Location Y:8484752-8484774
Sequence TTCTTATTCCTTGTGAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200906127_1200906133 23 Left 1200906127 Y:8484706-8484728 CCTGGGCTTGCTTGAATCCTCTC No data
Right 1200906133 Y:8484752-8484774 TTCTTATTCCTTGTGAATGTAGG No data
1200906130_1200906133 6 Left 1200906130 Y:8484723-8484745 CCTCTCTGGGCTTGCCTTGAGAA No data
Right 1200906133 Y:8484752-8484774 TTCTTATTCCTTGTGAATGTAGG No data
1200906132_1200906133 -8 Left 1200906132 Y:8484737-8484759 CCTTGAGAAAAAGGATTCTTATT No data
Right 1200906133 Y:8484752-8484774 TTCTTATTCCTTGTGAATGTAGG No data
1200906126_1200906133 24 Left 1200906126 Y:8484705-8484727 CCCTGGGCTTGCTTGAATCCTCT No data
Right 1200906133 Y:8484752-8484774 TTCTTATTCCTTGTGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200906133 Original CRISPR TTCTTATTCCTTGTGAATGT AGG Intergenic
No off target data available for this crispr