ID: 1200906136

View in Genome Browser
Species Human (GRCh38)
Location Y:8484781-8484803
Sequence AGCAACTGGTCATTTGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200906132_1200906136 21 Left 1200906132 Y:8484737-8484759 CCTTGAGAAAAAGGATTCTTATT No data
Right 1200906136 Y:8484781-8484803 AGCAACTGGTCATTTGTAGTAGG No data
1200906134_1200906136 -2 Left 1200906134 Y:8484760-8484782 CCTTGTGAATGTAGGCAGAGAAG No data
Right 1200906136 Y:8484781-8484803 AGCAACTGGTCATTTGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200906136 Original CRISPR AGCAACTGGTCATTTGTAGT AGG Intergenic
No off target data available for this crispr