ID: 1200910424

View in Genome Browser
Species Human (GRCh38)
Location Y:8526971-8526993
Sequence GTTTTTGAGGGATTTTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200910424_1200910429 5 Left 1200910424 Y:8526971-8526993 CCCATCAAAAATCCCTCAAAAAC No data
Right 1200910429 Y:8526999-8527021 GGACTATATTCCAAACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200910424 Original CRISPR GTTTTTGAGGGATTTTTGAT GGG (reversed) Intergenic
No off target data available for this crispr