ID: 1200914530

View in Genome Browser
Species Human (GRCh38)
Location Y:8559837-8559859
Sequence AGCTATCAGCAAAAGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200914530_1200914533 -6 Left 1200914530 Y:8559837-8559859 CCAACCATCTTTTGCTGATAGCT No data
Right 1200914533 Y:8559854-8559876 ATAGCTGCCTCTAGGCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200914530 Original CRISPR AGCTATCAGCAAAAGATGGT TGG (reversed) Intergenic
No off target data available for this crispr