ID: 1200914533

View in Genome Browser
Species Human (GRCh38)
Location Y:8559854-8559876
Sequence ATAGCTGCCTCTAGGCTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200914529_1200914533 -5 Left 1200914529 Y:8559836-8559858 CCCAACCATCTTTTGCTGATAGC No data
Right 1200914533 Y:8559854-8559876 ATAGCTGCCTCTAGGCTATTAGG No data
1200914531_1200914533 -10 Left 1200914531 Y:8559841-8559863 CCATCTTTTGCTGATAGCTGCCT No data
Right 1200914533 Y:8559854-8559876 ATAGCTGCCTCTAGGCTATTAGG No data
1200914530_1200914533 -6 Left 1200914530 Y:8559837-8559859 CCAACCATCTTTTGCTGATAGCT No data
Right 1200914533 Y:8559854-8559876 ATAGCTGCCTCTAGGCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200914533 Original CRISPR ATAGCTGCCTCTAGGCTATT AGG Intergenic
No off target data available for this crispr