ID: 1200919083

View in Genome Browser
Species Human (GRCh38)
Location Y:8597129-8597151
Sequence GGTGCCAGGCAGTCCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200919083_1200919086 -2 Left 1200919083 Y:8597129-8597151 CCTGGATGGGACTGCCTGGCACC No data
Right 1200919086 Y:8597150-8597172 CCACAGATCACTTAGCTGCCAGG No data
1200919083_1200919088 26 Left 1200919083 Y:8597129-8597151 CCTGGATGGGACTGCCTGGCACC No data
Right 1200919088 Y:8597178-8597200 CAGCGAGCATAAGAGACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200919083 Original CRISPR GGTGCCAGGCAGTCCCATCC AGG (reversed) Intergenic
No off target data available for this crispr