ID: 1200921265

View in Genome Browser
Species Human (GRCh38)
Location Y:8615511-8615533
Sequence CTGTAGTCGTGTCCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200921265_1200921270 -8 Left 1200921265 Y:8615511-8615533 CCTGCAGCAGGACACGACTACAG No data
Right 1200921270 Y:8615526-8615548 GACTACAGGGATGGCCTGAAGGG No data
1200921265_1200921271 -7 Left 1200921265 Y:8615511-8615533 CCTGCAGCAGGACACGACTACAG No data
Right 1200921271 Y:8615527-8615549 ACTACAGGGATGGCCTGAAGGGG No data
1200921265_1200921269 -9 Left 1200921265 Y:8615511-8615533 CCTGCAGCAGGACACGACTACAG No data
Right 1200921269 Y:8615525-8615547 CGACTACAGGGATGGCCTGAAGG No data
1200921265_1200921276 27 Left 1200921265 Y:8615511-8615533 CCTGCAGCAGGACACGACTACAG No data
Right 1200921276 Y:8615561-8615583 AAAATTTTAAGGTCCCACAGTGG No data
1200921265_1200921277 28 Left 1200921265 Y:8615511-8615533 CCTGCAGCAGGACACGACTACAG No data
Right 1200921277 Y:8615562-8615584 AAATTTTAAGGTCCCACAGTGGG No data
1200921265_1200921274 16 Left 1200921265 Y:8615511-8615533 CCTGCAGCAGGACACGACTACAG No data
Right 1200921274 Y:8615550-8615572 CCCTGATGTCTAAAATTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200921265 Original CRISPR CTGTAGTCGTGTCCTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr