ID: 1200921575

View in Genome Browser
Species Human (GRCh38)
Location Y:8618073-8618095
Sequence TGCCACAGGCAGAGCCGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200921575_1200921583 17 Left 1200921575 Y:8618073-8618095 CCATGCCGGCTCTGCCTGTGGCA No data
Right 1200921583 Y:8618113-8618135 AGGCAGACAGCTCTGACCTGTGG No data
1200921575_1200921579 -3 Left 1200921575 Y:8618073-8618095 CCATGCCGGCTCTGCCTGTGGCA No data
Right 1200921579 Y:8618093-8618115 GCAGTCTCCCCTGCTTAGGCAGG No data
1200921575_1200921578 -7 Left 1200921575 Y:8618073-8618095 CCATGCCGGCTCTGCCTGTGGCA No data
Right 1200921578 Y:8618089-8618111 TGTGGCAGTCTCCCCTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200921575 Original CRISPR TGCCACAGGCAGAGCCGGCA TGG (reversed) Intergenic
No off target data available for this crispr