ID: 1200921955

View in Genome Browser
Species Human (GRCh38)
Location Y:8621057-8621079
Sequence GCCAGGCTCCGTGTTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200921947_1200921955 18 Left 1200921947 Y:8621016-8621038 CCACCTGGGGTTTCCTGCAGAAC No data
Right 1200921955 Y:8621057-8621079 GCCAGGCTCCGTGTTTTTCTGGG No data
1200921948_1200921955 15 Left 1200921948 Y:8621019-8621041 CCTGGGGTTTCCTGCAGAACCAT No data
Right 1200921955 Y:8621057-8621079 GCCAGGCTCCGTGTTTTTCTGGG No data
1200921946_1200921955 19 Left 1200921946 Y:8621015-8621037 CCCACCTGGGGTTTCCTGCAGAA No data
Right 1200921955 Y:8621057-8621079 GCCAGGCTCCGTGTTTTTCTGGG No data
1200921949_1200921955 5 Left 1200921949 Y:8621029-8621051 CCTGCAGAACCATGCAGCCTCAG No data
Right 1200921955 Y:8621057-8621079 GCCAGGCTCCGTGTTTTTCTGGG No data
1200921951_1200921955 -4 Left 1200921951 Y:8621038-8621060 CCATGCAGCCTCAGCAGGTGCCA No data
Right 1200921955 Y:8621057-8621079 GCCAGGCTCCGTGTTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200921955 Original CRISPR GCCAGGCTCCGTGTTTTTCT GGG Intergenic
No off target data available for this crispr