ID: 1200923761

View in Genome Browser
Species Human (GRCh38)
Location Y:8636045-8636067
Sequence CCTGAAAGAGTGCAACACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200923761_1200923766 16 Left 1200923761 Y:8636045-8636067 CCCTGGTGTTGCACTCTTTCAGG No data
Right 1200923766 Y:8636084-8636106 ATGCAGCCTCAAGAGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200923761 Original CRISPR CCTGAAAGAGTGCAACACCA GGG (reversed) Intergenic