ID: 1200925158

View in Genome Browser
Species Human (GRCh38)
Location Y:8647694-8647716
Sequence GCTCATTTACAACATAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200925155_1200925158 -10 Left 1200925155 Y:8647681-8647703 CCCGCCTTTGGCAGCTCATTTAC No data
Right 1200925158 Y:8647694-8647716 GCTCATTTACAACATAAGACTGG No data
1200925148_1200925158 30 Left 1200925148 Y:8647641-8647663 CCAGAGTAGACAAAAGAAGATGT No data
Right 1200925158 Y:8647694-8647716 GCTCATTTACAACATAAGACTGG No data
1200925152_1200925158 3 Left 1200925152 Y:8647668-8647690 CCACGGGAGGAACCCCGCCTTTG No data
Right 1200925158 Y:8647694-8647716 GCTCATTTACAACATAAGACTGG No data
1200925154_1200925158 -9 Left 1200925154 Y:8647680-8647702 CCCCGCCTTTGGCAGCTCATTTA No data
Right 1200925158 Y:8647694-8647716 GCTCATTTACAACATAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200925158 Original CRISPR GCTCATTTACAACATAAGAC TGG Intergenic
No off target data available for this crispr