ID: 1200925304

View in Genome Browser
Species Human (GRCh38)
Location Y:8648985-8649007
Sequence AAGGTCCTGTTAAACTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200925301_1200925304 7 Left 1200925301 Y:8648955-8648977 CCTCCAAGCGCATGGAGCATTAT No data
Right 1200925304 Y:8648985-8649007 AAGGTCCTGTTAAACTCTGAAGG No data
1200925302_1200925304 4 Left 1200925302 Y:8648958-8648980 CCAAGCGCATGGAGCATTATAAA No data
Right 1200925304 Y:8648985-8649007 AAGGTCCTGTTAAACTCTGAAGG No data
1200925300_1200925304 8 Left 1200925300 Y:8648954-8648976 CCCTCCAAGCGCATGGAGCATTA No data
Right 1200925304 Y:8648985-8649007 AAGGTCCTGTTAAACTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200925304 Original CRISPR AAGGTCCTGTTAAACTCTGA AGG Intergenic
No off target data available for this crispr