ID: 1200926352

View in Genome Browser
Species Human (GRCh38)
Location Y:8658412-8658434
Sequence GTGGCTAGGTATTTGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200926352_1200926360 11 Left 1200926352 Y:8658412-8658434 CCTCTTCCCAAATACCTAGCCAC No data
Right 1200926360 Y:8658446-8658468 CCTCTTTCCTTAGCTTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200926352 Original CRISPR GTGGCTAGGTATTTGGGAAG AGG (reversed) Intergenic
No off target data available for this crispr