ID: 1200926360

View in Genome Browser
Species Human (GRCh38)
Location Y:8658446-8658468
Sequence CCTCTTTCCTTAGCTTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200926356_1200926360 -8 Left 1200926356 Y:8658431-8658453 CCACCTCTACCTGTTCCTCTTTC No data
Right 1200926360 Y:8658446-8658468 CCTCTTTCCTTAGCTTAGTCAGG No data
1200926354_1200926360 4 Left 1200926354 Y:8658419-8658441 CCAAATACCTAGCCACCTCTACC No data
Right 1200926360 Y:8658446-8658468 CCTCTTTCCTTAGCTTAGTCAGG No data
1200926352_1200926360 11 Left 1200926352 Y:8658412-8658434 CCTCTTCCCAAATACCTAGCCAC No data
Right 1200926360 Y:8658446-8658468 CCTCTTTCCTTAGCTTAGTCAGG No data
1200926355_1200926360 -3 Left 1200926355 Y:8658426-8658448 CCTAGCCACCTCTACCTGTTCCT No data
Right 1200926360 Y:8658446-8658468 CCTCTTTCCTTAGCTTAGTCAGG No data
1200926353_1200926360 5 Left 1200926353 Y:8658418-8658440 CCCAAATACCTAGCCACCTCTAC No data
Right 1200926360 Y:8658446-8658468 CCTCTTTCCTTAGCTTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200926360 Original CRISPR CCTCTTTCCTTAGCTTAGTC AGG Intergenic
No off target data available for this crispr