ID: 1200927544

View in Genome Browser
Species Human (GRCh38)
Location Y:8668118-8668140
Sequence AGTCTCCCGCTTCTATGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200927538_1200927544 6 Left 1200927538 Y:8668089-8668111 CCTTTACAGCCCCCAAGAAAAAA No data
Right 1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG No data
1200927539_1200927544 -3 Left 1200927539 Y:8668098-8668120 CCCCCAAGAAAAAAACTCTCAGT No data
Right 1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG No data
1200927542_1200927544 -6 Left 1200927542 Y:8668101-8668123 CCAAGAAAAAAACTCTCAGTCTC No data
Right 1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG No data
1200927540_1200927544 -4 Left 1200927540 Y:8668099-8668121 CCCCAAGAAAAAAACTCTCAGTC No data
Right 1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG No data
1200927536_1200927544 16 Left 1200927536 Y:8668079-8668101 CCATAAATTCCCTTTACAGCCCC No data
Right 1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG No data
1200927537_1200927544 7 Left 1200927537 Y:8668088-8668110 CCCTTTACAGCCCCCAAGAAAAA No data
Right 1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG No data
1200927541_1200927544 -5 Left 1200927541 Y:8668100-8668122 CCCAAGAAAAAAACTCTCAGTCT No data
Right 1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200927544 Original CRISPR AGTCTCCCGCTTCTATGTAA GGG Intergenic
No off target data available for this crispr