ID: 1200933129

View in Genome Browser
Species Human (GRCh38)
Location Y:8715186-8715208
Sequence CTGGACTTCCAGATTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200933129_1200933137 29 Left 1200933129 Y:8715186-8715208 CCTCCTTCAATCTGGAAGTCCAG No data
Right 1200933137 Y:8715238-8715260 ATGTGCACTACTAACCACCTTGG No data
1200933129_1200933135 3 Left 1200933129 Y:8715186-8715208 CCTCCTTCAATCTGGAAGTCCAG No data
Right 1200933135 Y:8715212-8715234 AAACTGGACTGAGGGAGACCAGG No data
1200933129_1200933133 -5 Left 1200933129 Y:8715186-8715208 CCTCCTTCAATCTGGAAGTCCAG No data
Right 1200933133 Y:8715204-8715226 TCCAGTTCAAACTGGACTGAGGG No data
1200933129_1200933132 -6 Left 1200933129 Y:8715186-8715208 CCTCCTTCAATCTGGAAGTCCAG No data
Right 1200933132 Y:8715203-8715225 GTCCAGTTCAAACTGGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200933129 Original CRISPR CTGGACTTCCAGATTGAAGG AGG (reversed) Intergenic
No off target data available for this crispr