ID: 1200934763

View in Genome Browser
Species Human (GRCh38)
Location Y:8728673-8728695
Sequence CTGTGGGGCTCTCTCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200934763_1200934772 12 Left 1200934763 Y:8728673-8728695 CCACCTGAGAGAGAGCCCCACAG No data
Right 1200934772 Y:8728708-8728730 CACACACAGAAGCCACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200934763 Original CRISPR CTGTGGGGCTCTCTCTCAGG TGG (reversed) Intergenic
No off target data available for this crispr