ID: 1200935440

View in Genome Browser
Species Human (GRCh38)
Location Y:8734387-8734409
Sequence CTCCTTTTCCGCCAAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200935434_1200935440 28 Left 1200935434 Y:8734336-8734358 CCCACAGAGAAGACAGGTGAGAG No data
Right 1200935440 Y:8734387-8734409 CTCCTTTTCCGCCAAGATGCAGG No data
1200935435_1200935440 27 Left 1200935435 Y:8734337-8734359 CCACAGAGAAGACAGGTGAGAGT No data
Right 1200935440 Y:8734387-8734409 CTCCTTTTCCGCCAAGATGCAGG No data
1200935436_1200935440 4 Left 1200935436 Y:8734360-8734382 CCACTGCTGACAGATGTCCATGG No data
Right 1200935440 Y:8734387-8734409 CTCCTTTTCCGCCAAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200935440 Original CRISPR CTCCTTTTCCGCCAAGATGC AGG Intergenic
No off target data available for this crispr