ID: 1200948073

View in Genome Browser
Species Human (GRCh38)
Location Y:8865681-8865703
Sequence CCTGGAGGACTGTAGGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200948059_1200948073 24 Left 1200948059 Y:8865634-8865656 CCCATGACAGTCGGGTGCACCAA No data
Right 1200948073 Y:8865681-8865703 CCTGGAGGACTGTAGGTATAAGG No data
1200948058_1200948073 25 Left 1200948058 Y:8865633-8865655 CCCCATGACAGTCGGGTGCACCA No data
Right 1200948073 Y:8865681-8865703 CCTGGAGGACTGTAGGTATAAGG No data
1200948068_1200948073 -10 Left 1200948068 Y:8865668-8865690 CCCTCCTCTGGCACCTGGAGGAC No data
Right 1200948073 Y:8865681-8865703 CCTGGAGGACTGTAGGTATAAGG No data
1200948060_1200948073 23 Left 1200948060 Y:8865635-8865657 CCATGACAGTCGGGTGCACCAAG No data
Right 1200948073 Y:8865681-8865703 CCTGGAGGACTGTAGGTATAAGG No data
1200948064_1200948073 5 Left 1200948064 Y:8865653-8865675 CCAAGGGAACGGATGCCCTCCTC No data
Right 1200948073 Y:8865681-8865703 CCTGGAGGACTGTAGGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200948073 Original CRISPR CCTGGAGGACTGTAGGTATA AGG Intergenic
No off target data available for this crispr