ID: 1200948291

View in Genome Browser
Species Human (GRCh38)
Location Y:8867426-8867448
Sequence AAGGGCCTATAGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200948284_1200948291 19 Left 1200948284 Y:8867384-8867406 CCTTTTTAAACTCTTCAAGTGCA No data
Right 1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200948291 Original CRISPR AAGGGCCTATAGAACTCTGG GGG Intergenic
No off target data available for this crispr