ID: 1200955254

View in Genome Browser
Species Human (GRCh38)
Location Y:8938190-8938212
Sequence GGAGGCACAGAGAGTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200955254_1200955261 11 Left 1200955254 Y:8938190-8938212 CCTTGCTCACTCTCTGTGCCTCC No data
Right 1200955261 Y:8938224-8938246 CTCTGCTCTGACCATGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200955254 Original CRISPR GGAGGCACAGAGAGTGAGCA AGG (reversed) Intergenic
No off target data available for this crispr