ID: 1200957882

View in Genome Browser
Species Human (GRCh38)
Location Y:8970094-8970116
Sequence TCCAGGATACCTCAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200957882_1200957886 -10 Left 1200957882 Y:8970094-8970116 CCACCCAGCTGAGGTATCCTGGA No data
Right 1200957886 Y:8970107-8970129 GTATCCTGGAGACGATGTACGGG No data
1200957882_1200957890 26 Left 1200957882 Y:8970094-8970116 CCACCCAGCTGAGGTATCCTGGA No data
Right 1200957890 Y:8970143-8970165 GTGCACATGCTGCACTGGAATGG No data
1200957882_1200957891 27 Left 1200957882 Y:8970094-8970116 CCACCCAGCTGAGGTATCCTGGA No data
Right 1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG No data
1200957882_1200957889 21 Left 1200957882 Y:8970094-8970116 CCACCCAGCTGAGGTATCCTGGA No data
Right 1200957889 Y:8970138-8970160 GTTGTGTGCACATGCTGCACTGG No data
1200957882_1200957887 -9 Left 1200957882 Y:8970094-8970116 CCACCCAGCTGAGGTATCCTGGA No data
Right 1200957887 Y:8970108-8970130 TATCCTGGAGACGATGTACGGGG No data
1200957882_1200957892 28 Left 1200957882 Y:8970094-8970116 CCACCCAGCTGAGGTATCCTGGA No data
Right 1200957892 Y:8970145-8970167 GCACATGCTGCACTGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200957882 Original CRISPR TCCAGGATACCTCAGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr