ID: 1200957883

View in Genome Browser
Species Human (GRCh38)
Location Y:8970097-8970119
Sequence GTCTCCAGGATACCTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200957883_1200957889 18 Left 1200957883 Y:8970097-8970119 CCCAGCTGAGGTATCCTGGAGAC No data
Right 1200957889 Y:8970138-8970160 GTTGTGTGCACATGCTGCACTGG No data
1200957883_1200957890 23 Left 1200957883 Y:8970097-8970119 CCCAGCTGAGGTATCCTGGAGAC No data
Right 1200957890 Y:8970143-8970165 GTGCACATGCTGCACTGGAATGG No data
1200957883_1200957892 25 Left 1200957883 Y:8970097-8970119 CCCAGCTGAGGTATCCTGGAGAC No data
Right 1200957892 Y:8970145-8970167 GCACATGCTGCACTGGAATGGGG No data
1200957883_1200957891 24 Left 1200957883 Y:8970097-8970119 CCCAGCTGAGGTATCCTGGAGAC No data
Right 1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200957883 Original CRISPR GTCTCCAGGATACCTCAGCT GGG (reversed) Intergenic
No off target data available for this crispr