ID: 1200957884

View in Genome Browser
Species Human (GRCh38)
Location Y:8970098-8970120
Sequence CGTCTCCAGGATACCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200957884_1200957891 23 Left 1200957884 Y:8970098-8970120 CCAGCTGAGGTATCCTGGAGACG No data
Right 1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG No data
1200957884_1200957889 17 Left 1200957884 Y:8970098-8970120 CCAGCTGAGGTATCCTGGAGACG No data
Right 1200957889 Y:8970138-8970160 GTTGTGTGCACATGCTGCACTGG No data
1200957884_1200957892 24 Left 1200957884 Y:8970098-8970120 CCAGCTGAGGTATCCTGGAGACG No data
Right 1200957892 Y:8970145-8970167 GCACATGCTGCACTGGAATGGGG No data
1200957884_1200957890 22 Left 1200957884 Y:8970098-8970120 CCAGCTGAGGTATCCTGGAGACG No data
Right 1200957890 Y:8970143-8970165 GTGCACATGCTGCACTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200957884 Original CRISPR CGTCTCCAGGATACCTCAGC TGG (reversed) Intergenic
No off target data available for this crispr