ID: 1200957888

View in Genome Browser
Species Human (GRCh38)
Location Y:8970111-8970133
Sequence TCGCCCCGTACATCGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200957888_1200957891 10 Left 1200957888 Y:8970111-8970133 CCTGGAGACGATGTACGGGGCGA No data
Right 1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG No data
1200957888_1200957892 11 Left 1200957888 Y:8970111-8970133 CCTGGAGACGATGTACGGGGCGA No data
Right 1200957892 Y:8970145-8970167 GCACATGCTGCACTGGAATGGGG No data
1200957888_1200957894 29 Left 1200957888 Y:8970111-8970133 CCTGGAGACGATGTACGGGGCGA No data
Right 1200957894 Y:8970163-8970185 TGGGGTATCATTGGCCAGTTAGG No data
1200957888_1200957893 20 Left 1200957888 Y:8970111-8970133 CCTGGAGACGATGTACGGGGCGA No data
Right 1200957893 Y:8970154-8970176 GCACTGGAATGGGGTATCATTGG No data
1200957888_1200957890 9 Left 1200957888 Y:8970111-8970133 CCTGGAGACGATGTACGGGGCGA No data
Right 1200957890 Y:8970143-8970165 GTGCACATGCTGCACTGGAATGG No data
1200957888_1200957889 4 Left 1200957888 Y:8970111-8970133 CCTGGAGACGATGTACGGGGCGA No data
Right 1200957889 Y:8970138-8970160 GTTGTGTGCACATGCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200957888 Original CRISPR TCGCCCCGTACATCGTCTCC AGG (reversed) Intergenic
No off target data available for this crispr