ID: 1200957891

View in Genome Browser
Species Human (GRCh38)
Location Y:8970144-8970166
Sequence TGCACATGCTGCACTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200957888_1200957891 10 Left 1200957888 Y:8970111-8970133 CCTGGAGACGATGTACGGGGCGA No data
Right 1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG No data
1200957884_1200957891 23 Left 1200957884 Y:8970098-8970120 CCAGCTGAGGTATCCTGGAGACG No data
Right 1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG No data
1200957882_1200957891 27 Left 1200957882 Y:8970094-8970116 CCACCCAGCTGAGGTATCCTGGA No data
Right 1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG No data
1200957883_1200957891 24 Left 1200957883 Y:8970097-8970119 CCCAGCTGAGGTATCCTGGAGAC No data
Right 1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200957891 Original CRISPR TGCACATGCTGCACTGGAAT GGG Intergenic
No off target data available for this crispr