ID: 1200957941

View in Genome Browser
Species Human (GRCh38)
Location Y:8970368-8970390
Sequence CCTGTGCACCAGAGAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200957941_1200957945 6 Left 1200957941 Y:8970368-8970390 CCAGACACTCTCTGGTGCACAGG No data
Right 1200957945 Y:8970397-8970419 GGAACAGCAAATACAAAGCCCGG No data
1200957941_1200957946 10 Left 1200957941 Y:8970368-8970390 CCAGACACTCTCTGGTGCACAGG No data
Right 1200957946 Y:8970401-8970423 CAGCAAATACAAAGCCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200957941 Original CRISPR CCTGTGCACCAGAGAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr