ID: 1200958318

View in Genome Browser
Species Human (GRCh38)
Location Y:8972842-8972864
Sequence GCTACTATGCCCCCACATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200958318_1200958321 -3 Left 1200958318 Y:8972842-8972864 CCGGCATGTGGGGGCATAGTAGC No data
Right 1200958321 Y:8972862-8972884 AGCAGGAGTGTTGTTCTTGTGGG No data
1200958318_1200958325 7 Left 1200958318 Y:8972842-8972864 CCGGCATGTGGGGGCATAGTAGC No data
Right 1200958325 Y:8972872-8972894 TTGTTCTTGTGGGTGGGTGGAGG No data
1200958318_1200958327 11 Left 1200958318 Y:8972842-8972864 CCGGCATGTGGGGGCATAGTAGC No data
Right 1200958327 Y:8972876-8972898 TCTTGTGGGTGGGTGGAGGGAGG No data
1200958318_1200958320 -4 Left 1200958318 Y:8972842-8972864 CCGGCATGTGGGGGCATAGTAGC No data
Right 1200958320 Y:8972861-8972883 TAGCAGGAGTGTTGTTCTTGTGG No data
1200958318_1200958326 8 Left 1200958318 Y:8972842-8972864 CCGGCATGTGGGGGCATAGTAGC No data
Right 1200958326 Y:8972873-8972895 TGTTCTTGTGGGTGGGTGGAGGG No data
1200958318_1200958322 0 Left 1200958318 Y:8972842-8972864 CCGGCATGTGGGGGCATAGTAGC No data
Right 1200958322 Y:8972865-8972887 AGGAGTGTTGTTCTTGTGGGTGG No data
1200958318_1200958324 4 Left 1200958318 Y:8972842-8972864 CCGGCATGTGGGGGCATAGTAGC No data
Right 1200958324 Y:8972869-8972891 GTGTTGTTCTTGTGGGTGGGTGG No data
1200958318_1200958323 1 Left 1200958318 Y:8972842-8972864 CCGGCATGTGGGGGCATAGTAGC No data
Right 1200958323 Y:8972866-8972888 GGAGTGTTGTTCTTGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200958318 Original CRISPR GCTACTATGCCCCCACATGC CGG (reversed) Intergenic
No off target data available for this crispr