ID: 1200959859

View in Genome Browser
Species Human (GRCh38)
Location Y:8986730-8986752
Sequence AGTGGCAACATAAACAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200959859_1200959864 1 Left 1200959859 Y:8986730-8986752 CCACCTCTGTTTATGTTGCCACT No data
Right 1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200959859 Original CRISPR AGTGGCAACATAAACAGAGG TGG (reversed) Intergenic
No off target data available for this crispr