ID: 1200959860

View in Genome Browser
Species Human (GRCh38)
Location Y:8986733-8986755
Sequence GGGAGTGGCAACATAAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200959860_1200959864 -2 Left 1200959860 Y:8986733-8986755 CCTCTGTTTATGTTGCCACTCCC No data
Right 1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200959860 Original CRISPR GGGAGTGGCAACATAAACAG AGG (reversed) Intergenic
No off target data available for this crispr