ID: 1200959864

View in Genome Browser
Species Human (GRCh38)
Location Y:8986754-8986776
Sequence CCATTCCCACAAAAAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200959859_1200959864 1 Left 1200959859 Y:8986730-8986752 CCACCTCTGTTTATGTTGCCACT No data
Right 1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG No data
1200959860_1200959864 -2 Left 1200959860 Y:8986733-8986755 CCTCTGTTTATGTTGCCACTCCC No data
Right 1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200959864 Original CRISPR CCATTCCCACAAAAAAAACT AGG Intergenic
No off target data available for this crispr