ID: 1200961369

View in Genome Browser
Species Human (GRCh38)
Location Y:8999063-8999085
Sequence CCTATTATGTAGGAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200961364_1200961369 10 Left 1200961364 Y:8999030-8999052 CCAAAATTATATAGAAGAATTGA No data
Right 1200961369 Y:8999063-8999085 CCTATTATGTAGGAGGAGAATGG No data
1200961363_1200961369 22 Left 1200961363 Y:8999018-8999040 CCAGATAATGCACCAAAATTATA No data
Right 1200961369 Y:8999063-8999085 CCTATTATGTAGGAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200961369 Original CRISPR CCTATTATGTAGGAGGAGAA TGG Intergenic
No off target data available for this crispr